Potato late blight, caused by the oomycete pathogen Phytophthora infestans , is one of the most devastating diseases affecting potato crops in the history. Although conventional detection methods of plant diseases such as PCR and LAMP are highly sensitive and specific, they rely on bulky and expensive laboratory equipment and involve complex operations, making them impracticable for point-of care diagnosis in the field. Here in this study, we report a portable RPA-CRISPR based diagnosis system for plant disease, integrating smartphone for acquisition and analysis of fluorescent images. A polyvinyl alcohol (PVA) microneedle patch was employed for sample extraction on the plant leaves within one minute, the DNA extraction efficiency achieved 56 μg/mg, which is ∼3 times to the traditional CTAB methods (18 μg/mg). The system of RPA-CRISPR-Cas12a isothermal assay was established to specifically target P. infestans with no cross-reactivity observed against closely-related species ( P. sojae , P. capsici ). The system demonstrated a detection limit of 2 pg/μL for P. infestans genomic DNA, offering sensitivity comparable to that of benchtop laboratory equipment. The system demonstrates the early-stage diagnosis capability by achieving a ∼80% and 100% detection rate on the third and fourth day post-inoculation respectively, before visible symptoms observed on the leaves. The smartphone-based “sample-to-result” system decouples the limitations of traditional methods that rely heavily on specialized equipment, offering a promising way for early-stage plant disease detection and control in the field.

Senescence has been shown to contribute to the progression of aging related diseases including degenerative disc disease (DDD). However, the mechanisms regulating senescence in the intervertebral disc (IVD) and other tissues/diseases remain poorly understood. Recently, in a CRISPRa genome-wide screen, our lab identified a previously uncharacterized zinc finger protein, ZNF865 (BLST), that regulates a wide array of genes related to protein processing, cell senescence and DNA damage repair. Here, we demonstrate that ZNF865 expression is correlated with age and disease state in human patient IVD samples and mouse IVD. Utilizing CRISPR-guided gene modulation, we show that ZNF865 is necessary for healthy cell function and is a critical protein in regulating senescence and DNA damage in intervertebral disc cells, with implications for a wide range of tissues and organs. We also demonstrate that downregulation of ZNF865 induces senescence and upregulation mitigates senescence and DNA damage in human nucleus pulposus (NP) cells. Importantly, upregulation of ZNF865 shifts the chromatin landscape and gene expression profile of human degenerative NP cells towards a healthy cell phenotype. Collectively, our findings establish ZNF865 as a novel modulator of genome stability and senescence and as a potential therapeutic target for mediating senescence/DNA damage in senescence related diseases and disorders. Summary Degenerative disc disease (DDD) is a major contributor to chronic low back pain, a leading cause of disability globally 1–3 . Cellular senescence has emerged as a key driver of disc degeneration 4,5 , characterized by cell-cycle arrest and the secretion of pro-inflammatory and matrix-degrading factors collectively termed the senescence-associated secretory phenotype (SASP). While the pathological role of senescent cells in musculoskeletal aging is increasingly recognized 6–8 , the upstream molecular regulators remain poorly understood. Here we identify a previously uncharacterized zinc finger protein, ZNF865, as a novel regulator of senescence and genomic stability in human nucleus pulposus (NP) cells. CRISPRi-mediated downregulation of ZNF865 in healthy NP cells induced senescence, increased expression of p16 and p21, and led to increases in DNA damage. Conversely, upregulation of ZNF865 in degenerative NP cells restored proliferation, suppressed senescence markers, reduced DNA damage, significantly diminished SASP factor secretion and restored transcriptomic and epigenetic profiles to a healthy phenotype. This study represents the first functional characterization of ZNF865 and establishes it as an important regulator for senescence in disc cells. These findings highlight ZNF865 as a promising therapeutic target for mitigating senescence-driven pathologies in DDD and potentially other age-related disorders.

CRISPR-associated transposons (CAST) enable programmable, RNA-guided DNA integration, marking a transformative advancement in genome engineering. A central player in the type V-K CAST system is the AAA+ ATPase TnsC, which assembles into helical filaments on double-stranded DNA (dsDNA) to orchestrate target site recognition and transposition. Despite its essential role, the molecular mechanisms underlying TnsC filament nucleation and elongation remain poorly understood. Here, multiple-microsecond and free energy simulations are combined with deep learning-based Graph Attention Network (GAT) models to elucidate the mechanistic principles of TnsC filament formation and growth. Our findings reveal that ATP binding promotes TnsC nucleation by inducing DNA remodelling and stabilizing key protein-DNA interactions, particularly through conserved residues in the initiator-specific motif (ISM). Furthermore, GNN-based attention analyses identify a directional bias in filament elongation in the 5′→3′ direction and uncover a dynamic compensation mechanism between incoming and bound monomers that facilitate directional growth along dsDNA. By leveraging deep learning–based graph representations, our GAT model provides interpretable mechanistic insights from complex molecular simulations and is readily adaptable to a wide range of biological systems. Altogether, these findings establish a mechanistic framework for TnsC filament dynamics and directional elongation, advancing the rational design of CAST systems with enhanced precision and efficiency.

Human Immunodeficiency Virus-1 (HIV) remains a major global public health challenge, having led to over 42.3 million deaths since its discovery in the early 1980s. Despite progress in prevention and treatment, around 60% of people with HIV (PWH) remain undiagnosed in resource-limited regions, disproportionately affecting vulnerable populations and underserved communities across the world. This illustrates the critical need for accessible, accurate, and equipment-free diagnostic tools to enhance detection and thus provide opportunities to curb its spread. Here, we developed a low-cost, robust, and label-free rolling circle amplification (RCA)-rCRISPR diagnostic platform for detecting HIV viral load with minimal instrumentation. Our strategy, combining the integration of RNA-detecting RCA reaction with plasmid reporter-based ratiometric CRISPR (rCRISPR), enables sensitive detection of unprocessed RNA targets without the need for intensive sample pre-treatment. This label-free RCA-rCRISPR diagnostic platform detected HIV RNA down to single-digit aM sensitivity (~3000 copies/mL) from PWH-derived HIV samples ex vivo . Unlike typical RCA, which requires sample fragmentations to break long RNA target sequences, our design harnesses the triple functions of the phi29 DNA polymerase (namely exonuclease activity, polymerization, and strand displacement), enabling the detection of the entire HIV genome without pre-fragmentation. For point-of-care (POC) applications, we constructed an all-in-one smartphone-based minigel electrophoresis device to facilitate equipment-free HIV viral load testing, making it accessible to resource-limited communities. Additionally, the assay has demonstrated the ability for point mutation detection ( BRAF mutation in canine urothelial carcinoma), showcasing the robustness of our strategy for broad disease diagnostic applications.

ABSTRACT Pneumocystis species are obligate fungal pathogens that cause severe pneumonia, particularly in immunocompromised individuals. The absence of robust genetic manipulation tools has impeded our mechanistic understanding of Pneumocystis biology and the development of novel therapeutic strategies. Herein, we describe a novel method for the stable transformation and CRISPR/Cas9-mediated genetic editing of Pneumocystis murina utilizing extracellular vesicles (EVs) as a delivery vehicle. Building upon our prior investigations demonstrating EV-mediated delivery of exogenous material to Pneumocystis , we engineered mouse lung EVs to deliver plasmid DNA encoding reporter genes and CRISPR/Cas9 components. Our initial findings demonstrated successful in vitro transformation and subsequent expression of mNeonGreen and Dhps ARS in P. murina organisms. Subsequently, we established stable in vivo expression of mNeonGreen in mice infected with transformed P. murina for a duration of up to 5 weeks. Furthermore, we designed and validated a CRISPR/Cas9 system targeting the P. murina Dhps gene, confirming its in vitro cleavage efficiency. Ultimately, we achieved successful in vivo CRISPR/Cas9-mediated homologous recombination, precisely introducing a Dhps ARS mutation into the P. murina genome, which was confirmed by Sanger sequencing across all tested animals. Here, we establish a foundational methodology for genetic manipulation in Pneumocystis , thereby opening avenues for functional genomics, drug target validation, and the generation of genetically modified strains for advanced research and potential therapeutic applications. IMPORTANCE Pneumocystis species are obligate fungal pathogens and major causes of pneumonia in immunocompromised individuals. However, their strict dependence on the mammalian lung environment has precluded the development of genetic manipulation systems, limiting our ability to interrogate gene function, study antifungal resistance mechanisms, or validate therapeutic targets. Here, we report the first successful approach for stable transformation and CRISPR/Cas9-based genome editing of Pneumocystis murina , achieved through in vivo delivery of engineered extracellular vesicles (EVs) containing plasmid DNA and encoding CRISPR/Cas9 components. We demonstrate sustained transgene expression and precise modification of the dhps locus via homology-directed repair. This modular, scalable platform overcomes a long-standing barrier in the field and establishes a foundation for functional genomics in Pneumocystis and other obligate, host-adapted microbes.

Prokaryotic microorganisms coexist with mobile genetic elements (MGEs), which can be both genetic threats and evolutionary catalysts. In Haloferax lucentense , a halophilic archaeon, we have recently identified an unusual genomic arrangement: a complete type I-B CRISPR-Cas system encoded on a mega-plasmid coexists with a partial counterpart within an integrated provirus in the main chromosome. The provirus-encoded system lacks the adaptation genes ( cas1, cas2 , and cas4 ), suggesting its potential reliance on the plasmid-encoded CRISPR-Cas module for the acquisition of new spacers. This arrangement suggests a potential instance of “adaptive outsourcing,” where a provirus might leverage a co-resident MGE for a key function. Through comparative genomics, we show that similar proviral CRISPR-Cas systems are found in distantly related haloarchaea (e.g., Natrinema and Halobacterium ), indicating probable virus-mediated horizontal transfer and suggesting they may function as mobile defense modules. Phylogenetic analysis highlights distinct evolutionary origins of the two systems: the plasmid system clusters with other Haloferax CRISPR-Cas systems, while the proviral system clusters with those from other genera, consistent with horizontal acquisition. Interestingly, spacer analysis reveals that the proviral systems predominantly target viral sequences, while the plasmid system appears to target both plasmids and viral sequences, a distribution mirroring broader trends observed in other plasmid- and chromosome-encoded CRISPR systems. This observed targeting preference suggests a potential for complementarity that could support a model of cooperative immunity, where each system may protect its genetic “owner” from competition and, indirectly, the host.

Abstract Characterizing the protospacer adjacent motif (PAM) requirements of different Cas enzymes is a bottleneck in the discovery of Cas proteins and their engineered variants in mammalian cell contexts. To overcome this challenge and to enable more scalable characterization of PAM preferences, we develop a method named GenomePAM that allows for direct PAM characterization in mammalian cells. GenomePAM leverages genomic repetitive sequences as target sites and does not require protein purification or synthetic oligos. GenomePAM uses a 20-nt protospacer that occurs ~16,942 times in every human diploid cell and is flanked by nearly random sequences. We demonstrate that GenomePAM can accurately characterize the PAM requirement of type II and type V nucleases, including the minimal PAM requirement of the near-PAMless SpRY and extended PAM for CjCas9. Beyond PAM characterization, GenomePAM allows for simultaneous comparison of activities and fidelities among different Cas nucleases on thousands of match and mismatch sites across the genome using a single gRNA and provides insight into the genome-wide chromatin accessibility profiles in different cell types.

Plants have long adapted to the earth’s changing environmental patterns. Yet, 1 with the current rise of abiotic stresses, such as salinity, temperatures, drought, and nutrient 2 depletion occurring at unpredictable rates threaten global agriculture. If this pattern keeps 3 continuing, then long-evolved regulatory mechanisms can become inadequate to keep 4 pace with environmental disturbances. Consequently, to work through these challenges, 5 human-targeted genetic interventions are requisite. In this review, the recent advancements 6 in plant resilience research, from evolutionary mechanisms (polyploidy, epigenetics, gene 7 duplication, etc.) to modern synthetic technologies (CRISPR-Cas, transgene technology, 8 nanotechnology, and artificial intelligence (AI)), are discussed to redefine the boundaries of 9 plant stress tolerance. By integrating these two domain principles, we can understand how 10 the evolutionary mechanisms can help us in designing precision tools to retain or integrate 11 the lost valuable genetic characteristics. Despite these advancements, major hurdles such 12 as limited field trials, specific isoform functional data, and plants’ ability to adopt these 13 resilient traits still remain. With human interventions and technological strategies, we can 14 improve the plant’s resilience. Here we are not replacing natural evolutionary adaptation, 15 but rather we are building a path for better plant adaptation in these environmental crisis 16 situations and laying the road to sustainable food systems.17

Diabetes and its retinal complication, diabetic retinopathy (DR), are a rapidly increasing health, societal and economic burden. Diabetic retinopathy is a complex disease with a chronic inflammatory component mediated by retinal microglial cells. Recent studies have demonstrated the importance of the Hippo pathway kinases, Ndr1/Stk38 and Ndr2/Stk38l , in the regulation of macrophages, immune cells that share similarities with microglial cells. However, the role of NDR2 kinases in microglial inflammatory response and in the pathophysiology of diabetic retinopathy has not yet been uncovered. This study investigates the role of NDR2 kinase in microglial cells, particularly in response to high glucose (HG) conditions. Using CRISPR-Cas9, we downregulated Ndr2 kinase in BV-2 microglial cells and analyzed the impact on cellular metabolism, phagocytosis and migratory capabilities. We demonstrate that microglial cells expressed NDR2 kinase protein, especially in HG conditions, suggesting its importance in regulating microglial functions during hyperglycemia. Ndr2 downregulated cells present a decreased basal respiration, indicating an impaired mitochondrial function. They also showed decreased metabolic flexibility to stress conditions, such as adaptation to HG conditions. Functionally, Ndr2 downregulation led to decreased phagocytic capacity and migration of microglial cells, both cytoskeleton-based functions. Furthermore, Ndr2 downregulation resulted in altered cytokine and chemokine secretion profiles. Notably, increased levels of pro-inflammatory cytokines such as IL-6, TNF, IL-17 and IL-12p70 were observed in Ndr2 downregulated cells, even under normal glucose conditions. In conclusion, our findings indicate that NDR2 kinase is crucial for microglial metabolic adaptation to stress, such as high glucose exposure and for influencing microglial inflammatory responses. Therefore, NDR2 kinase plays a vital role in maintaining microglial functional plasticity in response to glucose variations, suggesting potential implications for neuroinflammatory processes in conditions like diabetic retinopathy. Graphical abstract Research in Context What is already known about this subject? The pathogenesis of diabetic retinopathy (DR) involves chronic inflammation mediated by retinal microglial cells, which contribute to vascular damage and neurodegeneration. Microglial dysfunction under high glucose (HG) conditions exacerbates cytokine release and oxidative stress, driving DR progression. NDR kinases regulate inflammatory pathways in macrophages, but their role in microglia during DR was previously unexplored. What is the key question? How do NDR2 kinase regulate microglial inflammatory responses and functional adaptability in diabetic retinopathy? What are the new findings? NDR2 expression is upregulated in microglia exposed to HG. Ndr2 downregulation in microglia impairs metabolic flexibility, phagocytosis, and migration. Ndr2 downregulation disrupts cytoskeleton-dependent microglial functions, limiting their ability to adapt to metabolic stress. Ndr2 downregulation in microglia increases pro-inflammatory cytokines (IL-17, TNF) and reduces anti-inflammatory factors (sTNFRI, VEGF), exacerbating inflammation. How might this impact clinical practice? Targeting Ndr2 signaling could emerge as a therapeutic strategy to modulate microglial-driven inflammation, potentially slowing DR progression and complementing existing glycemic control approaches.

B cell malignancies, including chronic lymphocytic leukemia (CLL) and diffuse large B cell lymphoma (DLBCL), rely on dysregulated B cell receptor (BCR) signaling for survival and proliferation. Prohibitin 1 and 2 (PHB1, PHB2) are multifunctional proteins involved in mitochondrial function, IgM-type BCR signaling and other key oncogenic pathways, making them potential therapeutic targets in lymphomas. Here, we assessed the effects of five PHB-targeting small molecules - FL3, Mel6, Mel56, IN44, and Fluorizoline - on lymphoma cell lines as proof-of-concept study. PHB transcript and protein quantities were differentially affected and distinct patterns of antiproliferative effects and viability were observed. Across cell models, FL3, Mel56, and Mel6 displayed strongest effects. FL3 and Mel56 exerted strong cytotoxic effects, while Mel6 primarily slowed proliferation. IN44 showed modest but selective cytotoxic effects in an ABC-DLBCL model, while Fluorizoline selectively stopped proliferation of a Burkitt lymphoma model. Non-malignant stromal cells remained largely unaffected by Mel56, highlighting a potential therapeutic window of this inhibitor. Replacing the native IgM constant region by IgG in the MEC-1 CLL line using CRISPR-Cas9 resulted in a somewhat reduced, but not abrogated effect of Mel56 suggesting effects on additional pathways beyond the BCR. Together these data provide proof-of-concept evidence for PHB inhibition as a potential strategy to target B cell lymphomas.

Alpha-synuclein (SNCA) overexpression is implicated in Parkinson’s disease (PD) pathogenesis, making SNCA downregulation a promising therapeutic strategy. We developed a SNCA -targeted epigenome therapy using an all-in-one lentiviral vector (LV) carrying deactivated CRISPR/(d)Cas9, gRNA targeted at SNCA -intron1, and either the catalytic domain of DNA-methyltransferase3A (DNMT3A), or a synthetic repressor molecule of Krüppel-associated box (KRAB)/ methyl CpG binding protein 2 transcription repression domain (MeCp2-TRD). Therapeutic efficacy was evaluated in a new PD mouse model, generated with an adeno-associated viral vector carrying an engineered minigene comprised of the human (h)A53T- SNCA expressed via the human native regulatory region. Both therapeutic vectors reduced expression of α-synuclein in the substantia nigra (SN), with LV/dSaCas9-KRAB-MeCP2(TRD) demonstrating greater repression. LV/dSaCas9-KRAB-MeCP2(TRD) also significantly reduced pathological α-synuclein aggregation and phosphorylation (Ser129), and preserved tyrosine hydroxylase expression in the SN and the striatum. Behavioral analysis following LV/dSaCas9-KRAB-MeCP2(TRD) injection, showed significant improvement in motor deficits characteristic of our PD-mouse model. Safety assessments found normal blood counts, serum chemistry, and weights. Collectively, we provide in vivo proof-of-concept for our SNCA -targeted epigenome therapy in a PD-mouse model. Our results support the system’s therapeutic potential for PD and related synucleinopathies and establish the foundation for further preclinical studies toward investigational new drug enablement.

The ability to perturb multiple proteins simultaneously within the same cell is essential for understanding and re-engineering biological pathways. CRISPR-Cas12a mutants with inactivated DNAse but intact RNAse activity (dCas12a) retain the ability to process large CRISPR RNAs (crRNAs) arrays, enabling them to target multiple genomic loci in parallel. When coupled with transcriptional effector domains, these properties make Cas12a a promising platform for multi-locus transcriptional perturbation. However, current Cas12a-based CRISPRi systems exhibit limitations in processing of multi-crRNA arrays and transcriptional regulation. Here, we combine molecular and circuit-level engineering to develop a programmable Cas12a- based CRIPSRi system capable of strong, tunable, and simultaneous knockdown of six or more genes in a single cell without genomic DNA cleavage. We demonstrate the utility of this system by systematically perturbing a partially redundant set of Bone Morphogenetic Protein (BMP) receptors, enabling quantitative analysis of BMP signaling across diverse receptor configurations.

Although therapeutic genome editing holds great potential to remedy diverse inherited and acquired disorders, targeted installation of medium to large sized genomic modifications in therapeutically relevant cells remains challenging. We have developed an approach that permits DNA sequence assembly and integration in human cells leveraging CRISPR-targeted dual flap synthesis. This method, named prime assembly, allows for RNA-programmable site-specific integration of single- or double-stranded DNA fragments. Unlike homology-directed repair, prime assembly was similarly active in dividing and non-dividing cells. We applied prime assembly to perform targeted exon recoding, transgene integration, and megabase-scale rearrangements, including at therapeutically relevant loci in primary human cells. Prime assembly expands the capabilities of genome engineering by enabling the targeted integration of medium to large sized DNA sequences without relying on double-stranded DNA donors, nuclease-driven double strand breaks, or cell cycle progression.

Timely resolution of inflammation is essential to prevent tissue damage and maintain homeostasis. Immunometabolism is critical for innate immunity and inflammation. However, how metabolic enzymes and metabolites contribute to inflammatory resolution remains largely unknown. To identify the key metabolic mediators of inflammation resolution, we generated an AAV9-Sleeping Beauty CRISPR library comprising 17090 sgRNAs targeting 2682 mouse metabolic genes. We then conducted an in vivo CRISPR screen in type II alveolar epithelial cells (AECIIs)-specifically expressing Cas9 mice and uncovered a very long chain fatty acid elongase, ELOVL5, that promoted the resolution of lung inflammation after influenza virus infection. Deficiency of Elovl5 in mouse lung epithelial cells impaired lung inflammation resolution and tissue repair phenotype both in vitro and in vivo . Mechanistically, ELOVL5 bound to STING, inhibiting TBK1 interaction and translocation to the Golgi. These effects ultimately reduced STING-mediated inflammation and promoted AKT1-mediated tissue repair. In addition, ELOVL5 decreased eicosanoid levels in AECIIs to promote lung inflammation resolution. Supplement with ELOVL5 downstream products reversed the increased expression of inflammatory cytokines caused by Elovl5 deficiency. These results support an unrevealed mechanism for polyunsaturated fatty acid metabolism in the resolution of innate inflammation and provide paths toward treating inflammatory diseases through manipulating cellular lipid metabolism.

ABSTRACT Understanding the genetics of drug response in the protozoan Leishmania is critical for treatment strategies but is hindered by the parasite’s lack of RNAi and non-homologous end-joining. Here, we addressed this using CRISPR/Cas9 cytosine base editing for genome-wide loss-of-function screening in L. mexicana . The resulting datasets, accessible at www.LeishBASEeditDB.net , revealed numerous novel resistance and sensitivity biomarkers across five compounds: Sb III , miltefosine, amphotericin B, pentamidine, and the experimental arylmethylaminosteroid 1c. Key findings include transporter-linked cross-resistance, opposing drug responses among paralogs, and collateral sensitivities between sterol and sphingolipid metabolism. Among 41 validated candidates, we identified sterol defects in two novel amphotericin B resistance markers, discovered a regulator of tubulovesicular localization of the miltefosine transporter complex, and uncovered evidence for flagellar-mediated drug uptake. Parallel genome-wide fitness and motility screens mapped essential genes and revealed persister-like phenotypes. Our approach enables powerful reverse genetic screens across Leishmania species, advancing drug mechanism studies and guiding combination therapy designs.

Single-cell CRISPR activation/interference screens offer a direct route to causal gene-regulatory maps, yet existing deep-learning pipelines are GPU-intensive and yield hard-to-interpret latent factors. We introduce LazyNet, an explicitly Euler-integrated neural ODE whose paired log-linear-exp layer collapses multiplicative transcript interactions into a compact, mechanistically interpretable weight matrix. Training a three-replica ensemble on a 55k-cell, 30k-gene Perturb-seq dataset completes on a single CPU in <1 h, running 3 to 4 folder faster than transformer (scGPT) or state-space (RetNet) baselines while lowering global RMSE by ≈ 25 % and raising genome-wide Pearson r to 0.67. Averaged Jacobians, expanded in a 32*4 breadth-first search around seven ferroptosis seeds, recapitulated 15 of 27 benchmark regulators (56 % recall) within a 4 611 gene, 11 676 edge subgraph; 26.6 % of edges show ARCHS4 co-expression r ≥ 0.2 versus 5 % expected at random, and 523 overlap STRING interactions (hypergeometric p = 1.2e-5). Elasticity ranks uncover a previously unrecognized lysosomal-mitochondrial-immune module linking PSAP-mTOR, MFN2-TLR4 and ADCY10-SIRT3, generating experimentally testable hypotheses. By combining state-of-the-art predictive accuracy, laptop-level resource demands and one-to-one parameter interpretability, LazyNet democratizes causal network discovery from sparse two-snapshot screens, enabling small laboratories to move from large-scale perturbation data to mechanistic insight without GPUs or external pathway priors.

CRISPR/Cas9 genome editing has become an important and routine method in C. elegans research to generate new mutants and endogenously tag genes. One complication of CRISPR experiments is that the efficiency of single-guide RNA sequences can vary dramatically. One solution to this problem is to create an intermediate entry strain using the efficient and well-characterised dpy-10 guide RNA sequence. This “d10 entry strain” can then be used to generate your knock-in of interest. However, the dpy-10 sequence is not always suitable when creating an entry strain. For example, if your gene of interest is closely linked to dpy-10 on LGII or if you want to use the dpy-10 as a co-CRISPR marker for the creation of the entry strain then you can not use the dpy-10 sequence. This publication reports a synthetic guide sequence, GCTATCAACTATCCATATCG, that is not present in the C. elegans genome and can be used to create entry strains. This guide sequence is demonstrated to be relatively robust with a knock-in efficiency that varies from 1-11%. While this is lower than the efficiency observed with d10 entry strains, it is still sufficient for most applications. This guide sequence can be added to the C. elegans CRISPR toolkit and is particularly useful for generating entry strains where the standard dpy-10 guide sequence is not suitable.

Abstract Advances in genome engineering have improved our ability to perturb microbial metabolic networks, yet bioproduction campaigns often struggle with parsing complex metabolic datasets to efficiently enhance product titers. We address this challenge by coupling laboratory automation with machine learning to systematically optimize the production of isoprenol, a sustainable aviation fuel (SAF) precursor, in Pseudomonas putida . The simultaneous downregulation through CRISPR interference of combinations of up to four gene targets, guided by machine learning (ML), permitted us to increase isoprenol titer 5-fold in six consecutive DBTL cycles. Moreover, ML enabled us to swiftly explore a vast experimental design space of 800,000 possible combinations by strategically recommending approximately 400 priority constructs. High-throughput proteomics allowed us to validate CRISPRi downregulation and identify biological mechanisms driving production increases. Our work demonstrates that ML-driven automated DBTL cycles can rapidly enhance titers without specific biological knowledge, suggesting that it can be applied to any host, product, or pathway. *David N. Carruthers & Patrick C. Kinnunen contributed equally.

Abstract Schwann cells are vital to development and maintenance of the peripheral nervous system and their dysfunction has been implicated in a range of neurological and neoplastic disorders, including NF2 -related schwannomatosis ( NF2 -SWN). We have developed a novel human induced pluripotent stem cell (hiPSC) model for the study of Schwann cell differentiation in health and disease. We performed transcriptomic, immunofluorescence, and morphological analysis of hiPSC derived Schwann cell precursors (SPCs) and terminally differentiated Schwann cells (SCs) representing distinct stages of development. To further validate our findings, we performed integrated, cross-species analyses across multiple external datasets at bulk and single cell resolution. Our hiPSC model of Schwann cell development shared overlapping gene expression signatures with human amniotic mesenchymal stem cell (hAMSCs) derived SCs and in vivo mouse models, but also revealed unique features that may reflect species-specific aspects of Schwann cell biology. Moreover, we have identified gene co-expression modules that are dynamically regulated during hiPSC to SC differentiation associated with ear and neural development, cell fate determination, the NF2 gene, and extracellular matrix (ECM) organization. Through integrated analysis of multiple datasets and genetic disruption of NF2 via CRISPR-Cas9 gene editing in hiPSC derived SCPs, we have identified a series of novel ECM associated genes regulated by Merlin. Our hiPSC model further provides a tractable platform for studying Schwann cell development in the context of rare diseases such as NF2 -SWN which lack effective medical therapies.

Cancer repeatedly exploits attributes fundamental for morphogenesis to advance malignancy and metastasis. This is illustrated by lineage specific transcription factors that regulate neural crest migration representing frequent drivers of malignancy. One such example is the forkhead transcription factor FOXC1 where gain of function is a feature of diverse cancers that is associated with an unfavourable prognosis. Using RNA-, ChIP-sequencing and CRISPR interference, we show that Foxc1 binds a locus in a region of closed chromatin to induce expression of Arhgap36, a tissue-specific inhibitor of Protein Kinase A. Because PKA is a core Hedgehog (Hh) pathway inhibitor, Foxc1’s induction of Arhgap36 expression increases Hh activity. The function of Sufu, a PKA substrate and a second essential Hh pathway inhibitor, is likewise impaired. The resulting increased Hh pathway output is resistant to pharmacological inhibition of Smoothened , a phenotype of more aggressive cancers. The Foxc1-Arhgap36 relationship identified in murine cells was further evaluated in neuroblastoma, a neural crest derived pediatric malignancy. This demonstrated in a cohort of 1348 patients that high levels of ARHGAP36 are predictive of improved five-year survival. In individual neuroblastoma cell lines that express high levels of ARHGAP36, the acute suppression of ARHGAP36 by shRNA inhibition induced apoptosis and rapid cell death. Accordingly, this study has identified as a novel transcription factor which enhances ARHGAP36 expression, one that induces Hh activity in multiple tissues during development. It also establishes a model by which increased levels of FOXC1 via ARHGAP36 and PKA inhibition, dysregulate multiple facets of Hh signaling, and provides evidence demonstrating relevance to a common neural-crest derived malignancy.

DNA methylation is important to maintain genome stability, but alterations in genome-wide methylation patterns can produce widespread genomic effects, which have the potential to facilitate rapid adaptation. We investigate DNA methylation evolution in Arabidopsis thaliana during its colonization of the drought-prone Cape Verde Islands (CVI). We identified three high impact changes in genes linking histone modification to DNA methylation that underlie variation in DNA methylation within CVI. Gene body methylation is reduced in CVI relative to the Moroccan outgroup due to a 2.7-kb deletion between two VARIANT IN METHYLATION genes ( VIM2 and VIM4 ) that causes aberrant expression of the VIM2/4 homologs. Disruptions of CHROMOMETHYLASE 2 (CMT2) and a newly identified DNA methylation modulator, F-BOX PROTEIN 5 (FBX5), which we validated using CRISPR mutant analysis, contribute to DNA methylation of transposable elements (TEs) within CVI. Overall, our results reveal rapid methylome evolution driven largely by high impact variants in three genes.

Schizophrenia is a complex neuropsychiatric disorder with strong genetic underpinnings, yet the molecular mechanisms linking genetic risk to disrupted brain development remain poorly understood. Transcription factors (TFs) and chromatin regulators (CRs) are increasingly implicated in neuropsychiatric disorders, where their dysregulation may disrupt neurodevelopmental programs. Despite this, systematic functional interrogation in human models has been limited. Here, we combine pooled CRISPR interference (CRISPRi) screens with high- throughput single-cell multiomic profiling in hiPSC-derived neural progenitors and neurons to functionally assess 65 schizophrenia-associated genes. Based on public datasets and literature review, we selected 55 TFs and CRs, along with ten additional risk genes whose loss-of-function has been linked to schizophrenia. Our single-cell CRISPRi readouts revealed that perturbations in TFs and CRs converge on disrupting neurodevelopmental timing. CRISPRi of several factors delayed neural differentiation, whereas others, such as the knockdown of MCRS1, drove precocious neural commitment. Validation screens combined with cell cycle and metabolic indicators confirmed the differentiation-restricting or -promoting roles of these TFs and CRs. Multimodal trajectory analysis uncovered discrete transcriptional and epigenomic states representing delayed and accelerated neurodevelopment, enriched for schizophrenia GWAS loci and disease-relevant pathways. Gene regulatory network (GRN) inference identified TCF4 and ZEB1 as critical mediators opposing the neural differentiation trajectory. Functional overexpression of these TFs followed by chromatin profiling demonstrated that TCF4 restrains, while ZEB1 promotes, neural differentiation in a stage-specific and competitive manner. Furthermore, we show that MCRS1 represses ZEB1 expression, positioning MCRS1 as a key brake on premature neurodevelopment. Together, our study establishes a scalable framework that integrates genetic perturbation, single- cell multiomics, and GRN modeling to functionally annotate disease-linked genes. We reveal convergent regulatory axes that underlie altered neurodevelopmental timing in schizophrenia, offering mechanistic insights into how chromatin misregulation contributes to disease pathogenesis.

ABSTRACT Bone homeostasis is maintained through the balanced activity of osteoclasts, which resorb bone, and osteoblasts, which form new bone. Excessive osteoclast activity leads to bone loss and contributes to conditions like osteoporosis. Osteoclasts form a specialized adhesion structure called the actin ring that is crucial for bone resorption and relies on both the actin and microtubule cytoskeletons. Our previous studies identified the β-tubulin isotype TUBB6 as a regulator of actin ring dynamics essential for osteoclast function, and found ARHGAP10, a negative regulator of the GTPases CDC42 and RHOA, as a potential mediator of TUBB6 function. Here we show that ARHGAP10 as a novel microtubule-associated protein critical for osteoclast function. ARHGAP10 directly binds microtubules through its BAR-PH domain, which requires positively-charged lysine residues K37, K41 and K44 within the BAR domain. CRISPR/Cas9 mediated knockout of Arhgap10 affects the morphology of actin ring and impairs osteoclast resorption activity, correlated with altered actin ring dynamics. Complementation experiments reveal that the ability of ARHGAP10 to bind microtubules is essential for its role in osteoclast resorption activity. These findings uncover a novel cytoskeletal regulator in osteoclast and suggest that targeting the microtubule-actin interface via ARHGAP10 could represent a therapeutic strategy in bone loss disorder.

Desert Hedgehog (Dhh) mutations cause male infertility, testicular dysgenesis and Leydig cell dysfunction. However, the mechanisms by which Dhh regulates Leydig lineage commitment through receptor selectivity, transcriptional effector specificity, and steroidogenic coupling remain elusive. In this study, we identified a Dhh-Ptch2-Gli1-Sf1 signaling axis that is essential for the differentiation of stem Leydig cells (SLCs) by using CRISPR/Cas9-generated dhh / ptch2 mutants of Nile tilapia ( Oreochromis niloticus ) and SLC transplantation. The loss of Dhh recapitulated mammalian phenotypes, characterized by testicular hypoplasia and androgen insufficiency. Rescue experiments with 11-ketotesterone and a Dhh agonist, in conjunction with SLC transplantation, demonstrated that Dhh regulates the differentiation of SLCs rather than their survival. In vitro knockout experiments of ptch1 and ptch2 in SLCs indicated that Patched2 (Ptch2), rather than Ptch1, serves as the receptor for Dhh in SLCs. Furthermore, in vivo genetic rescue experiments indicated that while the ptch2 mutation did not affect testicular development, the Ptch2 mutation fully rescued the developmental disorders of the testes caused by the dhh mutation, thereby further corroborating Ptch2 as the receptor for Dhh in SLCs. Additionally, the Glioma-associated oncogene homolog 1 (Gli1, but not Gli2 or Gli3) functions as the transcriptional effector that drives the expression of steroidogenic factor 1 ( sf1 ). Transcriptomic and functional analyses further established that Dhh signaling directly couples Sf1 to SLC differentiation. This study provides mechanistic insights into Dhh-related Leydig cell dysfunction and presents novel targets for regenerative therapies. Highlights Dhh regulates the differentiation of SLCs rather than their survival Ptch2, rather than Ptch1, is the specific receptor for Dhh in SLCs Gli1, not Gli2 or Gli3, is the principal transcriptional activator of Dhh in SLCs Sf1 is a direct transcriptional target of Gli1 in SLCs differentiation

SUMMARY The proteinopathy of the RNA-binding protein TDP-43, characterized by nuclear clearance and cytoplasmic inclusion, is a hallmark of multiple neurodegenerative diseases, including amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), and Alzheimer’s disease (AD). Through CRISPR interference (CRISPRi) screening in human neurons, we identified the decapping enzyme scavenger (DCPS) as a novel genetic modifier of TDP-43 loss-of-function (LOF)-mediated neurotoxicity. Our findings reveal that TDP-43 LOF leads to aberrant mRNA degradation, via disrupting the properties and function of processing bodies (P-bodies). TDP-43 interacts with P-body component proteins, potentially influencing their dynamic equilibrium and assembly into ribonucleoprotein (RNP) granules. Reducing DCPS restores P-body integrity and RNA turnover, ultimately improving neuronal survival. Overall, this study highlights a novel role of TDP-43 in RNA processing through P-body regulation and identifies DCPS as a potential therapeutic target for TDP-43 proteinopathy-related neurodegenerative diseases.