Single carbon (C1) substrates are gaining importance as future feedstocks for the production of bio-based chemicals. Carbon dioxide, a major greenhouse gas, offers a promising alternative to the traditional feedstocks to shift towards C1-based, sustainable processes. Here, we present a synthetic autotrophic Komagataella phaffii ( Pichia pastoris ) that is able to produce itaconic acid by the direct conversion of CO 2 , achieving final titers of approximately 12 g L -1 in bioreactor cultivations. We show that a combined approach that integrates balancing the flux between the Calvin–Benson–Bassham (CBB) cycle and itaconic acid metabolism with process design was essential to enhance the production. Our study demonstrates the potential of K. phaffii as a microbial platform using CO 2 as the direct carbon source, aligning with the future goals of establishing sustainable bioprocesses.

Chronic obstructive pulmonary disease (COPD) severity correlates with airway microbial dysbiosis, yet bacteriophage roles remain unexplored. We characterised the lung virome by re-analysing 135 sputum metagenomes from 99 COPD patients and 36 healthy controls. We identified 1,308 viral operational taxonomic units, revealing progressively lower viral diversity correlating with disease severity. Whilst viral and bacterial diversity typically showed strong positive correlations, patients with frequent exacerbations uniquely exhibited decoupled viral-bacterial relationships, indicating disrupted ecological dynamics. Phages infecting anaerobic oral bacteria showed disproportionately lower abundance— Porphyromonas phages were 40-fold less abundant despite only 4-fold lower bacterial abundance—whilst pathogen-associated phages showed no significant differences. We detected virulence factor-encoding phages, including two neuA -carrying Haemophilus phages in 7.4% of Haemophilus -colonised patients, associated with 82-fold higher bacterial abundance. These findings establish altered bacteriophage ecology as an unrecognised feature of COPD pathobiology, with differential phage-bacteria relationships that reshape lung microbial ecosystems, offering new perspectives for microbiome-targeted interventions.

CRISPR/Cas9 genome editing has become an important and routine method in C. elegans research to generate new mutants and endogenously tag genes. One complication of CRISPR experiments is that the efficiency of single-guide RNA sequences can vary dramatically. One solution to this problem is to create an intermediate entry strain using the efficient and well-characterised dpy-10 guide RNA sequence. This “d10 entry strain” can then be used to generate your knock-in of interest. However, the dpy-10 sequence is not always suitable when creating an entry strain. For example, if your gene of interest is closely linked to dpy-10 on LGII or if you want to use the dpy-10 as a co-CRISPR marker for the creation of the entry strain then you can not use the dpy-10 sequence. This publication reports a synthetic guide sequence, GCTATCAACTATCCATATCG, that is not present in the C. elegans genome and can be used to create entry strains. This guide sequence is demonstrated to be relatively robust with a knock-in efficiency that varies from 1-11%. While this is lower than the efficiency observed with d10 entry strains, it is still sufficient for most applications. This guide sequence can be added to the C. elegans CRISPR toolkit and is particularly useful for generating entry strains where the standard dpy-10 guide sequence is not suitable.

Abstract Advances in genome engineering have improved our ability to perturb microbial metabolic networks, yet bioproduction campaigns often struggle with parsing complex metabolic datasets to efficiently enhance product titers. We address this challenge by coupling laboratory automation with machine learning to systematically optimize the production of isoprenol, a sustainable aviation fuel (SAF) precursor, in Pseudomonas putida . The simultaneous downregulation through CRISPR interference of combinations of up to four gene targets, guided by machine learning (ML), permitted us to increase isoprenol titer 5-fold in six consecutive DBTL cycles. Moreover, ML enabled us to swiftly explore a vast experimental design space of 800,000 possible combinations by strategically recommending approximately 400 priority constructs. High-throughput proteomics allowed us to validate CRISPRi downregulation and identify biological mechanisms driving production increases. Our work demonstrates that ML-driven automated DBTL cycles can rapidly enhance titers without specific biological knowledge, suggesting that it can be applied to any host, product, or pathway. *David N. Carruthers & Patrick C. Kinnunen contributed equally.

Abstract Schwann cells are vital to development and maintenance of the peripheral nervous system and their dysfunction has been implicated in a range of neurological and neoplastic disorders, including NF2 -related schwannomatosis ( NF2 -SWN). We have developed a novel human induced pluripotent stem cell (hiPSC) model for the study of Schwann cell differentiation in health and disease. We performed transcriptomic, immunofluorescence, and morphological analysis of hiPSC derived Schwann cell precursors (SPCs) and terminally differentiated Schwann cells (SCs) representing distinct stages of development. To further validate our findings, we performed integrated, cross-species analyses across multiple external datasets at bulk and single cell resolution. Our hiPSC model of Schwann cell development shared overlapping gene expression signatures with human amniotic mesenchymal stem cell (hAMSCs) derived SCs and in vivo mouse models, but also revealed unique features that may reflect species-specific aspects of Schwann cell biology. Moreover, we have identified gene co-expression modules that are dynamically regulated during hiPSC to SC differentiation associated with ear and neural development, cell fate determination, the NF2 gene, and extracellular matrix (ECM) organization. Through integrated analysis of multiple datasets and genetic disruption of NF2 via CRISPR-Cas9 gene editing in hiPSC derived SCPs, we have identified a series of novel ECM associated genes regulated by Merlin. Our hiPSC model further provides a tractable platform for studying Schwann cell development in the context of rare diseases such as NF2 -SWN which lack effective medical therapies.

Cancer repeatedly exploits attributes fundamental for morphogenesis to advance malignancy and metastasis. This is illustrated by lineage specific transcription factors that regulate neural crest migration representing frequent drivers of malignancy. One such example is the forkhead transcription factor FOXC1 where gain of function is a feature of diverse cancers that is associated with an unfavourable prognosis. Using RNA-, ChIP-sequencing and CRISPR interference, we show that Foxc1 binds a locus in a region of closed chromatin to induce expression of Arhgap36, a tissue-specific inhibitor of Protein Kinase A. Because PKA is a core Hedgehog (Hh) pathway inhibitor, Foxc1’s induction of Arhgap36 expression increases Hh activity. The function of Sufu, a PKA substrate and a second essential Hh pathway inhibitor, is likewise impaired. The resulting increased Hh pathway output is resistant to pharmacological inhibition of Smoothened , a phenotype of more aggressive cancers. The Foxc1-Arhgap36 relationship identified in murine cells was further evaluated in neuroblastoma, a neural crest derived pediatric malignancy. This demonstrated in a cohort of 1348 patients that high levels of ARHGAP36 are predictive of improved five-year survival. Accordingly, this study has identified as a novel transcription factor which enhances ARHGAP36 expression, one that induces Hh activity in multiple tissues during development. It also establishes a model by which increased levels of FOXC1 via ARHGAP36 and PKA inhibition dysregulate multiple facets of Hh signaling, and provides evidence demonstrating relevance to a common neural-crest derived malignancy.

DNA methylation is important to maintain genome stability, but alterations in genome-wide methylation patterns can produce widespread genomic effects, which have the potential to facilitate rapid adaptation. We investigate DNA methylation evolution in Arabidopsis thaliana during its colonization of the drought-prone Cape Verde Islands (CVI). We identified three high impact changes in genes linking histone modification to DNA methylation that underlie variation in DNA methylation within CVI. Gene body methylation is reduced in CVI relative to the Moroccan outgroup due to a 2.7-kb deletion between two VARIANT IN METHYLATION genes ( VIM2 and VIM4 ) that causes aberrant expression of the VIM2/4 homologs. Disruptions of CHROMOMETHYLASE 2 (CMT2) and a newly identified DNA methylation modulator, F-BOX PROTEIN 5 (FBX5), which we validated using CRISPR mutant analysis, contribute to DNA methylation of transposable elements (TEs) within CVI. Overall, our results reveal rapid methylome evolution driven largely by high impact variants in three genes.

Schizophrenia is a complex neuropsychiatric disorder with strong genetic underpinnings, yet the molecular mechanisms linking genetic risk to disrupted brain development remain poorly understood. Transcription factors (TFs) and chromatin regulators (CRs) are increasingly implicated in neuropsychiatric disorders, where their dysregulation may disrupt neurodevelopmental programs. Despite this, systematic functional interrogation in human models has been limited. Here, we combine pooled CRISPR interference (CRISPRi) screens with high- throughput single-cell multiomic profiling in hiPSC-derived neural progenitors and neurons to functionally assess 65 schizophrenia-associated genes. Based on public datasets and literature review, we selected 55 TFs and CRs, along with ten additional risk genes whose loss-of-function has been linked to schizophrenia. Our single-cell CRISPRi readouts revealed that perturbations in TFs and CRs converge on disrupting neurodevelopmental timing. CRISPRi of several factors delayed neural differentiation, whereas others, such as the knockdown of MCRS1, drove precocious neural commitment. Validation screens combined with cell cycle and metabolic indicators confirmed the differentiation-restricting or -promoting roles of these TFs and CRs. Multimodal trajectory analysis uncovered discrete transcriptional and epigenomic states representing delayed and accelerated neurodevelopment, enriched for schizophrenia GWAS loci and disease-relevant pathways. Gene regulatory network (GRN) inference identified TCF4 and ZEB1 as critical mediators opposing the neural differentiation trajectory. Functional overexpression of these TFs followed by chromatin profiling demonstrated that TCF4 restrains, while ZEB1 promotes, neural differentiation in a stage-specific and competitive manner. Furthermore, we show that MCRS1 represses ZEB1 expression, positioning MCRS1 as a key brake on premature neurodevelopment. Together, our study establishes a scalable framework that integrates genetic perturbation, single- cell multiomics, and GRN modeling to functionally annotate disease-linked genes. We reveal convergent regulatory axes that underlie altered neurodevelopmental timing in schizophrenia, offering mechanistic insights into how chromatin misregulation contributes to disease pathogenesis.

ABSTRACT Adult-bone homeostasis is maintained through the reciprocal actions of osteoclasts and osteoblasts, which respectively resorb and deposit new bone. Excessive osteoclast activity leads to bone loss and contributes to conditions like osteoporosis. Osteoclasts form a specialized adhesion structure called the actin ring that is crucial for bone resorption and relies on both the actin and microtubule cytoskeletons. Our previous studies identified the β-tubulin isotype TUBB6 as a regulator of actin ring dynamics essential for osteoclast function, and found ARHGAP10, a negative regulator of the GTPases CDC42 and RHOA, as a potential mediator of TUBB6 function. Here we show that ARHGAP10 is a novel microtubule-associated protein critical for osteoclast function. ARHGAP10 directly binds microtubules through its BAR-PH domain, which requires positively-charged lysine residues K37, K41 and K44 within the BAR domain. CRISPR/Cas9 mediated knockout of Arhgap10 affects the morphology of the actin ring and impairs osteoclast resorption activity, correlated with altered actin ring dynamics. Complementation experiments reveal that the ability of ARHGAP10 to bind microtubules and to negatively regulate RHO-GTPases are essential for its role in osteoclast resorption activity. These findings uncover a novel cytoskeletal regulator in osteoclasts and suggest that targeting the microtubule-actin interface via ARHGAP10 could represent a therapeutic strategy in bone loss disorder.

Desert Hedgehog (Dhh) mutations cause male infertility, testicular dysgenesis and Leydig cell dysfunction. However, the mechanisms by which Dhh regulates Leydig lineage commitment through receptor selectivity, transcriptional effector specificity, and steroidogenic coupling remain elusive. In this study, we identified a Dhh-Ptch2-Gli1-Sf1 signaling axis that is essential for the differentiation of stem Leydig cells (SLCs) by using CRISPR/Cas9-generated dhh / ptch2 mutants of Nile tilapia ( Oreochromis niloticus ) and SLC transplantation. The loss of Dhh recapitulated mammalian phenotypes, characterized by testicular hypoplasia and androgen insufficiency. Rescue experiments with 11-ketotesterone and a Dhh agonist, in conjunction with SLC transplantation, demonstrated that Dhh regulates the differentiation of SLCs rather than their survival. In vitro knockout experiments of ptch1 and ptch2 in SLCs indicated that Patched2 (Ptch2), rather than Ptch1, serves as the receptor for Dhh in SLCs. Furthermore, in vivo genetic rescue experiments indicated that while the ptch2 mutation did not affect testicular development, the Ptch2 mutation fully rescued the developmental disorders of the testes caused by the dhh mutation, thereby further corroborating Ptch2 as the receptor for Dhh in SLCs. Additionally, the Glioma-associated oncogene homolog 1 (Gli1, but not Gli2 or Gli3) functions as the transcriptional effector that drives the expression of steroidogenic factor 1 ( sf1 ). Transcriptomic and functional analyses further established that Dhh signaling directly couples Sf1 to SLC differentiation. This study provides mechanistic insights into Dhh-related Leydig cell dysfunction and presents novel targets for regenerative therapies. Highlights Dhh regulates the differentiation of SLCs rather than their survival Ptch2, rather than Ptch1, is the specific receptor for Dhh in SLCs Gli1, not Gli2 or Gli3, is the principal transcriptional activator of Dhh in SLCs Sf1 is a direct transcriptional target of Gli1 in SLCs differentiation

SUMMARY The proteinopathy of the RNA-binding protein TDP-43, characterized by nuclear clearance and cytoplasmic inclusion, is a hallmark of multiple neurodegenerative diseases, including amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), and Alzheimer’s disease (AD). Through CRISPR interference (CRISPRi) screening in human neurons, we identified the decapping enzyme scavenger (DCPS) as a novel genetic modifier of TDP-43 loss-of-function (LOF)-mediated neurotoxicity. Our findings reveal that TDP-43 LOF leads to aberrant mRNA degradation, via disrupting the properties and function of processing bodies (P-bodies). TDP-43 interacts with P-body component proteins, potentially influencing their dynamic equilibrium and assembly into ribonucleoprotein (RNP) granules. Reducing DCPS restores P-body integrity and RNA turnover, ultimately improving neuronal survival. Overall, this study highlights a novel role of TDP-43 in RNA processing through P-body regulation and identifies DCPS as a potential therapeutic target for TDP-43 proteinopathy-related neurodegenerative diseases.

ABSTRACT US28 is a human cytomegalovirus-encoded chemokine receptor homologue that has high agonist-independent activity, internalizes constitutively, and plays an oncomodulatory role in glioblastoma. As G protein signaling was originally believed to strictly occur at the plasma membrane, it has been assumed that US28’s constitutive Gα q/11 signaling is mediated by a minor population at the plasma membrane. However, accumulating evidence shows that some GPCRs activate G proteins from intracellular organelles, such as endosomes. Importantly, endosomal rather than plasma membrane G protein signaling has been associated with transcriptional activity. Here, we demonstrate that the endosomal US28 population robustly activates Gα q/11 , and thus, provides the major contribution of Gα q/11 signaling. Surprisingly, US28 signaling at the plasma membrane rather than from endosomes primarily drives upregulation of gene expression involved in cell proliferation and inflammatory responses that are associated with glioblastoma and cancer. Our findings highlight the crucial role of receptor signaling location in cellular responses.

We introduce a high-affinity split-HaloTag comprised of a short peptide tag (Hpep, 14 residues) and a large, inactive fragment (cpHaloΔ3). Hpep binds to cpHaloΔ3 spontaneously with nanomolar affinity, enabling subsequent labeling with fluorescent HaloTag ligands. The small size of Hpep facilitates cloning-free endogenous protein tagging using CRISPR/Cas9 and the complementation of Hpep-tagged proteins can be achieved in live cells through co-expression with cpHaloΔ3 and in fixed cells through incubation with cpHaloΔ3. The approach is compatible with advanced microscopy techniques such as expansion microscopy and live-cell STED imaging. Additionally, variants of Hpep that modulate the spectral properties of labeled fluorophores enable simultaneous imaging of two different Hpep-tagged proteins via fluorescence lifetime microscopy. In summary, our high-affinity split-HaloTag is a robust and versatile tool for live-cell imaging and diverse applications in chemical biology.

Parkinson’s disease (PD) is a progressive neurodegenerative disorder characterised by the loss of dopaminergic neurons, driven by complex molecular mechanisms that are not fully understood. To address this issue, we have developed a novel high-content phenotypic screening platform using human induced pluripotent stem cell-derived dopaminergic neurons to investigate the PINK1-PARKIN mitophagy pathway, a critical process in PD pathogenesis. Utilising high throughput, 384 well arrayed CRISPR-CAS9 genetic manipulation and high-content immunofluorescence imaging complemented with machine learning analysis, we examined ubiquitin (Ub) pSer65 levels. Ub pSer65, a potential PD clinical biomarker, is a key marker of mitophagy initiation in dopaminergic neurons upon mitophagy initiation using exogenous stimuli to mimic the disease relevant environment. The CRISPR-CAS9 knockout (KO) screen revealed two distinct phenotypic classes: essential genes causing cell death upon deletion, and genes modulating Ub pSer65 levels. Notably, KO of PINK1, PARKIN , and TOM7 genes decreased Ub pSer65 upregulation during mitophagy activation, confirming their established roles in the pathway and validating the suitability of the platform for target identification. This innovative platform provides a precise tool to further interrogate PD-associated genes, offering insights into mitophagy-related pathogenic mechanisms and identification of potential therapeutic targets. By bridging functional genomics with disease-specific neuronal models, this approach presents a promising strategy for advancing PD research and developing targeted interventions. To our knowledge, this is the first reported use of a human, translationally relevant cell model to study genetic perturbation within a disease relevant phenotype.

GBA1 is a risk gene for multiple neurodegenerative diseases, including Lewy Body Dementia and Parkinson’s disease, and biallelic pathogenic variants in the gene result in the lysosomal storage disorder Gaucher disease. GBA1 encodes the enzyme glucocerebrosidase (GCase), and alterations in the gene result in reduced enzymatic activity, which affects lysosome function downstream. Induced pluripotent stem cells (iPSCs) are a useful tool for testing the functional consequences of gene variants in an isogenic setting. Additionally, they can be used to perform multiomic studies to explore biological effects independent of disease mechanisms. Using CRISPR-edited isogenic KOLF2.1J iPSC lines containing pathogenic GBA1 variants D409H (p.D448H), D409V (p.D448V) and GBA1 knockout line generated by the iPSC Neurodegenerative Disease Initiative (iNDI), we examined potential molecular mechanisms and downstream consequences of GCase reduction. In this study, we confirm that this isogenic series behaves as expected for loss of function variants, despite the known difficulties with GBA1 editing. We identified that there are limited overlapping results across cell types suggesting potential different downstream effects caused by GBA1 variants. Additionally, we note that RNA-based quantitation may not be the best method to characterize GCase mechanisms, but protein and metabolomic analyses may be used to evaluate differences across genotypes.

The Spindle Assembly Checkpoint (SAC) plays critical roles in regulating mitotic fidelity and progression. Here, we utilized a SAC-deficient cell line lacking the full-length Cdc20 translational protein isoform (Cdc20 ΔFL) to define its differential genetic interactions using CRISPR/Cas9-based gene targeting. Cdc20 ΔFL cells display synthetic lethal relationships with gene targets required for proper chromosome segregation, highlighting the critical role of the SAC in error surveillance. Surprisingly, we found that the checkpoint component Mad2 becomes dispensable for viability in Cdc20 ΔFL cells. Prior work suggested that Mad2 acts as an essential mitotic “timer” to control mitotic duration in unperturbed cells. Instead, our functional analysis indicates that the mitotic timer depends on the interdependent and overlapping actions of: (1) Mad2 inhibition of APC/C-Cdc20, (2) Cdk1-mediated phosphorylation of Cdc20, and (3) total Cdc20 protein levels. Simultaneously perturbing these pathways results in near immediate mitotic exit and catastrophic chromosome mis-segregation.

ABSTRACT Delivery of gene therapy vectors targeted to any somatic cell remains a key barrier for the development of genetic medicines. While rodent models provide insights into vector biodistribution and cellular tropism, their anatomical and physiological differences from humans limit their translational potential and studies in large animal models are often required. In this study, we developed a swine reporter model (SRM-1) to evaluate both viral and nonviral vector delivery in a large animal system. The SRM-1 model harbors a Cre- and CRISPR-activated tdTomato reporter at the Rosa26 locus that allows for tracing of cell-specific delivery and expression of gene therapy vectors in vivo . To evaluate this model, we administered adeno-associated virus serotype 9 (AAV9) and lipid nanoparticles (LNPs) carrying mRNA systemically and found successful in vivo reporter activation across a variety of tissues. Intracerebroventricular (ICV) administration of LNP-Cre mRNA was also performed and demonstrated localized activation in cortical brain cells. In addition to biodistribution studies, this model has utility for testing safety and clinically relevant administration methods, surgical and non-surgical, of delivery vectors. Our findings support the SRM-1 model as a valuable tool for advancing gene therapies from preclinical testing to clinical application.

ABSTRACT RNA-based vaccines offer a superior efficacious and economic approach over traditional vaccines. However, current dose requirement and short half-life of conventional modified mRNA (modRNA) may hinder the development of more effective vaccines. Self-amplifying mRNA (saRNA) is a modality that has the potential to address these limitations by reducing delivery dosage and enhancing the duration of expression over modRNA. Despite marked success in preclinical studies, saRNA vaccines have thus far underperformed in most clinical trials. We hypothesized that non-optimal human cellular context limits saRNA expression, and that elucidating the factors underlying saRNA expression would be key in developing saRNA as a viable therapeutic modality. To identify factors involved in the regulation of saRNA, we performed a quasi-genome-wide CRISPR knockout screen, which revealed that saRNA expression in human cells is linked to mitochondrial function and governed by ACSL4. We validated these findings through pharmacological intervention and single gene editing, demonstrating that ACSL4-mediated regulation is unique to saRNA and does not impact modRNA. Moreover, we show that modulating ACSL4 leads to improved saRNA expression across multiple cell types. We demonstrate for the first time that mitochondrial function and ACSL4 play key roles in saRNA expression, providing insight for the development and implementation of saRNA as a therapeutic modality.

Genome-wide CRISPR-Cas9 knockout screens is often used to evaluate gene functions experimentally. Nevertheless, the efficacy of individual sgRNAs that target unique gene varies and is hard to integrate. In this study, tensor decomposition (TD) was used to integrate multiple sgRNAs as well as sgRNA profiles simultaneously. As a result, TD can discriminate between essential and non-essential genes with the competitive performances of one of SOTA, JACKS, which previously outperformed various SOTA. In addition to this, in spite of that TD is nothing but the simple linear algebra, TD can achieve the performance even without control samples without which JACKS even cannot be performed. Moreover, since raw and logarithmic values can achieve the similar performances through TD for the largest dataset among those tested, taking logarithmic values as has been done frequently is questioned. In conclusion, TD is the ever first method that can integrate multiple sgRNAs and profiles simultaneously and can achieve comparative performances with JACKS, one of SOTA.

Mapping protein–protein interactions (PPIs) in living systems is critical for understanding dynamic biological processes. While proximity-labeling enzymes like LOV-TurboID and APEX2 are widely used, their dependence on external light, reactive chemicals, or large fusion domains limits in vivo applications, especially in deep tissues. Here, we introduce LucID (Light-free Unifying Catalytic Integrated Domain) – a compact, self-contained proximity-labeling system that functions independently of light or external ROS. LucID was engineered by embedding a minimal catalytic motif derived from TurboID into a NanoLuc scaffold, preserving bioluminescence while enabling spatially confined biotinylation. Upon luciferin addition, LucID leverages BRET (bioluminescence resonance energy transfer) to uncage the catalytic site and activate biotin transfer. With a molecular weight of approximately 23.7 kDa (40% smaller than TurboID), LucID is optimized for delivery via mRNA-LNP platforms. Its modularity and light-independent activation make it a unique tool for real-time interactome mapping in live cells and deep tissues. LucID introduces a new paradigm in proximity labeling: compact, luminescent, and chemically programmable. By integrating catalytic motifs into a light-producing scaffold, LucID enables temporally precise, spatially confined interactome mapping in challenging biological contexts. This innovation holds promise for single-cell proteomics, in vivo interaction studies, and next-generation bioimaging tools. Graphical Abstract | LucID enables light-free, ultra-compact biotinylation via BRET-triggered ROS uncaging LucID is a next-generation proximity labeling tool that combines NanoLuc bioluminescence, engineered TurboID motifs, and a ROS-cleavable thioketal cage to perform spatially precise biotinylation without external light. Upon luciferin addition, BRET triggers localized ROS generation, rapidly cleaving the cage (2.4–3.6 ns) and activating the catalytic site. This compact, self-contained platform enables deep-tissue labeling with high temporal control, making it ideal for in vivo proteomics, CRISPR fusions, and light-inaccessible systems.LucID is a next-generation proximity labeling tool that combines NanoLuc bioluminescence, engineered TurboID motifs, and a ROS-cleavable thioketal cage to perform spatially precise biotinylation without external light. Upon luciferin addition, BRET triggers localized ROS generation, rapidly cleaving the cage (2.4–3.6 ns) and activating the catalytic site. This compact, self-contained platform enables deep-tissue labeling with high temporal control, making it ideal for in vivo proteomics, CRISPR fusions, and light-inaccessible systems.

In Drosophila melanogaster females, as in most organisms, the segregation of meiotic chromosomes depends on the proper distribution of crossovers along paired maternal and paternal chromosomes. In most cases, crossovers require the synaptonemal complex (SC), a conserved multi-protein structure that forms between homologous chromosomes in meiotic prophase I. Recent studies leveraging hypomorphic alleles suggest that the SC plays a more direct role in the distribution of crossover events. However, identifying additional hypomorphic mutations that avoid catastrophic phenotypes by partially disrupting the SC has been challenging. Here, to create a new hypomorphic allele of the D. melanogaster SC gene corolla , we used CRISPR/Cas9 to replace it with the coding sequence of its Drosophila mauritiana ortholog, yielding corolla mau . Since the amino acid sequence of SC proteins is rapidly diverging while maintaining the general tripartite structure of the SC, we hypothesized that this replacement would enable the assembly of the SC but show defects in crossover distribution. Indeed, at 25 °C corolla mau homozygous females exhibited full-length SC with defects in SC maintenance and crossover formation, resulting in moderate levels of chromosome missegregation. At 18 °C, SC maintenance was rescued, and recombination rates were improved, although they remained significantly lower than observed in wild type. Importantly, these phenotypes are less severe than observed in corolla null mutant flies, suggesting corolla mau is a hypomorphic allele. Unexpectedly, in homozygotes we also observed unique polycomplexes composed of the SC proteins Corolla and Corona but lacking the transverse filament protein C(3)G. Overall, we report a novel hypomorphic allele of corolla that will enable future studies on the role of the SC in crossover distribution. Further, the unique polycomplexes found in mutant flies may provide new insights into SC protein-protein interactions and SC architecture. Author Summary In many species, the success of sexual reproduction relies on a protein structure called the synaptonemal complex (SC). The SC forms between the maternal and paternal copies of chromosomes and functions to ensure crossing over. Most prior studies have used SC mutants that have grave defects, preventing the study of nuances in SC function. Here, we replace one of the SC genes in Drosophila melanogaster with the ortholog of a close relative, creating a new allele that displays a partial loss-of-function phenotype. At the standard rearing temperature, flies homozygous for this allele exhibit SC maintenance defects, a reduced number of crossover events, and aberrant chromosome segregation. In flies reared at a lower temperature, SC maintenance is rescued but the defects in recombination and chromosome segregation persist. We also found a unique SC protein aggregate in these flies. Altogether, this new mutant reflects a novel approach to study the structure and function of the SC.

CRISPR screening is a powerful approach to identify genetic perturbations that impact viral infection. However, most virus-focused CRISPR screens utilize selection strategies that limit the ability to identify genes important for infection. Here, we developed a novel CRISPR screening pipeline to identify cellular determinants of Human Cytomegalovirus infection based on virally induced remodeling of cellular antibody affinity (VIRCAA), which is scalable for large libraries and can identify cellular genes that impact HCMV infection at different life cycle stages. We utilized this pipeline to interrogate proteomic and transcriptomic data sets associated with the HCMV UL26 protein, which blocks anti-viral signaling during infection. We find that JUNB drives anti-viral gene expression, induces protein ISGylation, and suppresses diverse viral infections. Further, UL26 proximally interacts with JUNB and suppresses JUNB’s nuclear condensation and JUNB-mediated contraction of viral DNA replication compartments. These results highlight the VIRCAA pipeline’s utility for identifying important determinants of viral infection.

ABSTRACT Hyperactive enzymes drive the pathology of several diseases, and classically, “occupancy-driven” drugs (e.g., active site or allosteric inhibitors) are used to target these enzymes. However, the stoichiometric nature of such inhibitors and the emergence of resistance highlight the need for new modalities. Here, we report a Phosphorylation-Inducing Chimeric Small molecule (PHICS) that rewires the hyperactivity of an oncogenic kinase, BCR-ABL, to phosphorylate its active site residue. Molecular dynamics simulations suggest this phosphorylation inhibits BCR-ABL by inducing electrostatic rearrangements of its active site. This “event-driven” mechanism selectively induces apoptosis of BCR-ABL-dependent cancer cells at substoichiometric concentrations (vs. stoichiometric concentrations of occupancy-driven drugs). Furthermore, PHICS is effective on other oncogenic ABL fusions or clinically observed resistance mutations, including to occupancy-driven drugs with the same binding site as PHICS, pointing to the orthogonality of their resistance mechanisms. These studies lay the foundation for electric-field and “event-driven” modalities to control hyperactive enzymes with orthogonal resistance mechanisms to occupancy-driven modalities.

Interactions between microbes and their mobile genetic elements (MGEs), including viruses and plasmids, are critical drivers of microbiome structures and processes. CRISPR-Cas systems are known to be important regulators of these host-MGE interactions, but a global understanding of CRISPR-Cas diversity, activity, and roles across Earth’s biomes is still lacking. Here, we use an optimized computational approach to search short-read data and collect ∼800 million CRISPR spacers across ∼450,000 public metagenomes. Comparing spacers across samples and taxa revealed a high population diversity for CRISPR loci overall, with typically only a small subset of spacers detected as prevalent and conserved within a microbial population. From this extensive CRISPR spacer dataset, we identified 1.18 billion hits between 41 million spacers and 2.5 million viruses and plasmids. Prevalent and conserved spacers were over-represented in these MGE-matching spacers, and CRISPR spacers frequently matched multiple MGEs, consistent with a positive selection pressure associated with MGE targeting. Focusing on the role of CRISPR as anti-phage defense, we observed surprising cases of viruses targeted by microbes not expected to be viable hosts. These were more frequent for viruses encoding a diversification mechanism (DGR) for their host attachment proteins, and associated with a reduced rate of escape mutations. This suggests that broad spacer targeting may derive from the recurring entry of a virus genome into a non-host microbial cell, leading to some viruses being targeted by taxonomically diverse microbes well outside of their actual host range. Taken together, this petabase-scale exploration of CRISPR arrays in nature outlines the extensive diversity of CRISPR array loci across microbiomes. It highlights several key genomic and ecological parameters driving the activity of CRISPR arrays that are likely influencing strain-level diversification and selection processes within microbial populations.

Summary CRISPR-Cas systems confer prokaryotic adaptive immunity by integrating foreign DNA (prespacers) into host arrays. Type II-A systems employ Cas9 for protospacer adjacent motif (PAM) recognition and coordinate with Csn2 and the Cas1-Cas2 integrase during spacer acquisition, yet their structural basis remains unresolved. Here, we report cryo-EM structures of the Enterococcus faecalis Cas9-Csn2-Cas1-Cas2 supercomplex in apo and DNA-bound states. The apo-state structure (Cas9 2 -Csn2 8 -Cas1 8 -Cas2 4 ) adopts a resting conformation, with Cas9 locked in a nuclease-inactive state and Cas1-Cas2 sterically blocked from prespacer loading. Upon DNA engagement, Cas9 undergoes a conformational transition, forming a prespacer catching complex that threads the DNA through Csn2’s central channel. This architecture enables Cas9 to interrogate the PAM sequence while sliding along the DNA, with Cas9 and Csn2 jointly define a 30-bp DNA segment which matches the prespacer length. Subsequent dissociation of Cas9 triggers a structural reconfiguration of the Csn2-Cas1-Cas2 assembly. The PAM-proximal DNA becomes accessible, and Cas1-Cas2 relocates to bind to the exposed DNA, enabling further prespacer processing and directional integration. These findings reveal how Cas9 collaborates with Csn2 and Cas1-Cas2 to couple PAM recognition with prespacer selection, resolving the dynamic structural transitions that ensure fidelity during type II-A CRISPR adaptation.